Authors
Kourosh Honarmand Ebrahimi1, Peter-Leon Hagedoorn1, Laura van der Weel1, Peter D. E. M. Verhaert1, and Wilfred R. Hagen1
Organizations
- Department of Biotechnology, Delft University of Technology, Julianalaan 67, 2628BC Delft, The Netherlands
Abstract
Storage of iron in a nontoxic and bioavailable form is essential for many forms of life. Three subfamilies of the ferritin-like superfamily, namely, ferritin, bacterioferritin, and Dps (DNA-binding proteins from starved cells), are able to store iron. Although the function of these iron-storage proteins is constitutive to many organisms to sustain life, the genome of some organisms appears not to encode any of these proteins. In an attempt to identify new iron-storage systems, we have found and characterized a new member of the ferritin-like superfamily of proteins, which unlike the multimeric storage system of ferritin, bacterioferritin, and Dps is monomeric in the absence of iron. Monomers catalyze oxidation of Fe(II) and they store the Fe(III) product as they assemble to form structures comparable to those of 24-meric ferritin. We propose that this mechanism is an alternative method of iron storage by the ferritin-like superfamily of proteins in organisms that lack the regular preassociated 24-meric/12-meric ferritins.
CovalX Technology Used (Click each option to learn more)
Outcomes
2 ng of Pyrococcus furiosus genomic DNA was used for PCR amplification of the PF1 196 gene to determine if it shares common ancestors with ferritins and rubrerythrins because of its iron-storage capacity. Because of these qualities it has been given the name archaeoferritin (AFR). A forward primer (CAGCCCATGGACATTGAAGAAG) and a reverse primer (ATTGGTACCTCACCGTGCTC) were designed. The PCR product was purified and cloned using KpnI and NcoI restriction enzymes in the pBAD/A vector. TOP10 Escherichia coli was used as the protein expression host strain with the vector. Cells were then cultivated at 37 °C using terrific broth medium before being allowed to sit for 2 hours after which the protein production was induced with 0.02% arabinose. Cells were harvested after 8 hours using a centrifuge and then broken using a cell disrupter (pressure of 1.35 kbar). The supernatant was collected and washed with 100 mM 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (pH 7.0) and concentrated using filters witha 10-kDa cutoff. The final protein product was purified from E. coli proteins through a single heat step (85 °C for 25 minutes) and its final concentration was measured using a bicinchoninic acid assay reagent with bovine serum albumin as a standard.
Analysis of samples was performed on both cross-linked and non cross-linked proteins. 1 μL of each non cross-linked protein was mixed with 1 μL of matrix (sinapic acid (10 mg/ml) in acetonitrile/water (1:1, v/v) and 0.1% TFA) before 1 μL of the mixture was spotted on a MALDI plate, crystallized at room temperature and analyzed in a MALDI mass spectrometer that had been modified with a CovalX HM2 detection system. The same procedure was followed except for the addition of 9 μL of the CovalX K200 Stabilization Kit (2 mg/ml) to 1 μL of each control protein. The samples were incubated at room temperature for 1 to 6 hours before being subjected to the same analysis procedure as the control proteins. The data was analyzed using the CovalX Complex Tracker software.
Source
10.1007/s00775-012-0913-0